View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20929_high_27 (Length: 215)

Name: NF20929_high_27
Description: NF20929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20929_high_27
NF20929_high_27
[»] chr7 (2 HSPs)
chr7 (83-197)||(26280141-26280256)
chr7 (86-197)||(26284721-26284832)
[»] chr5 (1 HSPs)
chr5 (78-169)||(39186966-39187057)
[»] chr2 (1 HSPs)
chr2 (141-187)||(27004323-27004369)


Alignment Details
Target: chr7 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 83 - 197
Target Start/End: Complemental strand, 26280256 - 26280141
Alignment:
83 gaaactaacatgatagtttgttaaatttttcacgtgtgatctgcaactagagttaatgacttcaaattcattatgctatgctttatctc--tgaagtgtg 180  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||  | ||||| |    
26280256 gaaactaacatgatagtttgttaaatttttcacgtgtgatctgcaactagagttaatgacttcaaattcattatgctatgctttatctcttttaagtg-g 26280158  T
181 tcattcaccacatgctt 197  Q
    |||||||||||||||||    
26280157 tcattcaccacatgctt 26280141  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 86 - 197
Target Start/End: Complemental strand, 26284832 - 26284721
Alignment:
86 actaacatgatagtttgttaaatttttcacgtgtgatctgcaactagagttaatgacttcaaattcattatgctatgctttatctctgaagtgtgtcatt 185  Q
    ||||||||||||||||  ||||||||||||  || || |||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||    
26284832 actaacatgatagtttcgtaaatttttcacaagtaatttgcaactagaattaatgacttcaaattcattatgctatgctttatctctcaagtgtgtcatt 26284733  T
186 caccacatgctt 197  Q
    ||||||| ||||    
26284732 caccacaggctt 26284721  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 68; Significance: 2e-30; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 78 - 169
Target Start/End: Original strand, 39186966 - 39187057
Alignment:
78 ttgacgaaactaacatgatagtttgttaaatttttcacgtgtgatctgcaactagagttaatgacttcaaattcattatgctatgctttatc 169  Q
    |||| ||||||||| |||||||||| ||||||||||| |||||||||||||||||||||||| ||||||||||||||||| |||||||||||    
39186966 ttgatgaaactaacgtgatagtttggtaaatttttcaggtgtgatctgcaactagagttaataacttcaaattcattatgttatgctttatc 39187057  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 141 - 187
Target Start/End: Original strand, 27004323 - 27004369
Alignment:
141 acttcaaattcattatgctatgctttatctctgaagtgtgtcattca 187  Q
    |||||||||  |||||| |||||||||||||| ||||||||||||||    
27004323 acttcaaatatattatggtatgctttatctctcaagtgtgtcattca 27004369  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University