View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20929_high_9 (Length: 293)
Name: NF20929_high_9
Description: NF20929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20929_high_9 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 156; Significance: 6e-83; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 17 - 252
Target Start/End: Original strand, 28735353 - 28735588
Alignment:
| Q |
17 |
agagaaagtgattcattccccatcctcgcattttaactttgtctttagattttaaagatattccacgtccaggaatttacgcatcgattaagttgaagtc |
116 |
Q |
| |
|
||||||||| |||| |||||||||| ||||||||||||||||||||||||||||| |||||||| || |||||||||| |||||||||||||||||||| |
|
|
| T |
28735353 |
agagaaagttattcgttccccatccacgcattttaactttgtctttagattttaatgatattccgcggccaggaatttttgcatcgattaagttgaagtc |
28735452 |
T |
 |
| Q |
117 |
gggctaaatctactgcaaatacttttaatatgatgcaattttttcttatgttggagattgtattttgcaggagaaagcacacagtgatttctacttattt |
216 |
Q |
| |
|
|| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||| || |||| |
|
|
| T |
28735453 |
aggataaatctactgcaaatacttttcatatgatgcaattttttcttatgttggagattgtattttgcaggagaaagcactcaaagatttctgctaattt |
28735552 |
T |
 |
| Q |
217 |
gataggtaaagatgcatacttaatattcccatggtt |
252 |
Q |
| |
|
|||||| |||||||| ||||||||||| ||| |||| |
|
|
| T |
28735553 |
gatagggaaagatgcctacttaatatttccaaggtt |
28735588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 219 - 281
Target Start/End: Original strand, 28730842 - 28730904
Alignment:
| Q |
219 |
taggtaaagatgcatacttaatattcccatggtttactgtgttttacattttggttggttttc |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28730842 |
taggtaaagatgcatacttaatattcccatggtttactgtgttttacattttggttggttttc |
28730904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University