View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20929_low_17 (Length: 247)
Name: NF20929_low_17
Description: NF20929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20929_low_17 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 4 - 247
Target Start/End: Complemental strand, 26203873 - 26203630
Alignment:
| Q |
4 |
actgatatgaagtgaagaggttgggtgcgtgtgggtcccacttaatctctttcttaaccccc-actttccattttatagactcaccacatcaccgacgca |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26203873 |
actgatatgaagtgaagaggttgggtgcgtgtgggtcccacttaatctctttcttaaccccccactttccattttatacactcaccacatcaccgacgca |
26203774 |
T |
 |
| Q |
103 |
taccaaacactcaaatnnnnnnntcaattcaactccaactaactccaccagccaccaccatgacgacggcgatctcggtggcggaacccgaactgaaaac |
202 |
Q |
| |
|
|||||| ||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26203773 |
taccaagcactcaaataaaaaaatcaattcaactc-aactaactccaccagccaccaccatgacgacggcgatctcggtggcggaacccgaactgaaaac |
26203675 |
T |
 |
| Q |
203 |
atactggtgccacgaatgtgacatgagcgtttctttaactacttc |
247 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26203674 |
atactggtgccacgaatgtgacatgagtgtttctttaactacttc |
26203630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University