View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20929_low_26 (Length: 223)
Name: NF20929_low_26
Description: NF20929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20929_low_26 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 4162755 - 4162954
Alignment:
| Q |
18 |
ttggaatctactttcttgtaaccactttgtattagtcatatcatagtggattggagagctattatctcccctaggtgtaggataaatttgtctgaactgt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| || |||||| |
|
|
| T |
4162755 |
ttggaatctactttcttgtaaccactttgtattagtcatatcatagtggattggagagttattctctcccctaggtgtaggataaatttatccgaactgg |
4162854 |
T |
|
| Q |
118 |
attttgtcttctctcttaagcttgttgttttgttatgcat--------atggtgttgttttacacttctttgattttgattactctttcctttactccac |
209 |
Q |
| |
|
||||| ||||||||||||| ||||||| |||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4162855 |
attttatcttctctcttaaccttgttgctttgttatgcttctctcttaaccttgttgttttacacttctttgattttgattactctttcctttactccac |
4162954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 29 - 108
Target Start/End: Complemental strand, 5077830 - 5077751
Alignment:
| Q |
29 |
tttcttgtaaccactttgtattagtcatatcatagtggattggagagctattatctcccctaggtgtaggataaatttgt |
108 |
Q |
| |
|
||||||||||||||||||||| | || ||||||||||||||||| ||||| | ||| ||||| |||||||||||||||| |
|
|
| T |
5077830 |
tttcttgtaaccactttgtatcactcttatcatagtggattggatagctactttctttcctagatgtaggataaatttgt |
5077751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 29 - 109
Target Start/End: Complemental strand, 11772040 - 11771960
Alignment:
| Q |
29 |
tttcttgtaaccactttgtattagtcatatcatagtggattggagagctattatctcccctaggtgtaggataaatttgtc |
109 |
Q |
| |
|
|||||| ||||| |||||||| | || ||||||||||||||||| || | | |||||||||| |||| ||||||||||| |
|
|
| T |
11772040 |
tttcttttaacctctttgtatcactcttatcatagtggattggaaagttgatctctcccctagatgtaacataaatttgtc |
11771960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 23 - 75
Target Start/End: Complemental strand, 28388089 - 28388037
Alignment:
| Q |
23 |
atctactttcttgtaaccactttgtattagtcatatcatagtggattggagag |
75 |
Q |
| |
|
||||| |||||||||||| |||||||| | |||| | |||||||||||||||| |
|
|
| T |
28388089 |
atctaatttcttgtaacctctttgtatcaatcattttatagtggattggagag |
28388037 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University