View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2092_high_6 (Length: 470)
Name: NF2092_high_6
Description: NF2092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2092_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 316; Significance: 1e-178; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 316; E-Value: 1e-178
Query Start/End: Original strand, 3 - 377
Target Start/End: Complemental strand, 25847773 - 25847405
Alignment:
| Q |
3 |
ccaccacatcaagacctactgcaccgtttacaaatccgaatccaaatccaaattcgaaaccgattcattattcacaacaacagcagcaaccacaacaaca |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
25847773 |
ccaccacatcaagacctactgcaccgtttacaaatccgaatccaaatccaaattcgaaaccgattcattatccacaacaacaacagcaaccacaacaaca |
25847674 |
T |
|
| Q |
103 |
agcgcttcatgttcgttccccaaatccttttctttacccattcgcgtcaccttcacgcgcttccgcaaatcatgctgttggcggttatcctccaccacct |
202 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
25847673 |
agcgcttcatgttcgttccccaaacccttttctttacccattcgcgtcaccttcacgcgcttctgcgaatcatgctgttggcggttatcctccaccacct |
25847574 |
T |
|
| Q |
203 |
cctccgtcgcatccgcagccgcagccgccacttttgtattcccacggcggcggtgttcgtgggatgaatttggattatctaagtcacgctttgcacgtga |
302 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25847573 |
cctccgt------cgcagccgcagccgccacttttgtattctcacggcggcggtgttcgtggtatgaatttggattatctaagtcacgctttgcacgtga |
25847480 |
T |
|
| Q |
303 |
ctagaccgctttcgcacgtgcagttccctcatcttgctgctactgcttcgcctcctgttaaaggacacctcaagg |
377 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25847479 |
ctagaccgctatcgcacgtgcagttccctcatcttgctgctactgcttcgcctcctgttaaagggcacctcaagg |
25847405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 230 - 346
Target Start/End: Complemental strand, 52321790 - 52321674
Alignment:
| Q |
230 |
ccacttttgtattcccacggcggcggtgttcgtgggatgaatttggattatctaagtcacgctttgcacgtgactagaccgctttcgcacgtgcagttcc |
329 |
Q |
| |
|
|||||||||||||| ||| | ||| |||||||||| ||||||||||| | ||||| || | ||||| |||||||||| || || || | |||||||| |
|
|
| T |
52321790 |
ccacttttgtattctcactggggcagtgttcgtggtgtgaatttggataacttaagtaacaccttgcatatgactagacccctctctcatgagcagttcc |
52321691 |
T |
|
| Q |
330 |
ctcatcttgctgctact |
346 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
52321690 |
ctcatcttgctgctact |
52321674 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University