View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2092_low_25 (Length: 253)
Name: NF2092_low_25
Description: NF2092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2092_low_25 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 23 - 243
Target Start/End: Complemental strand, 28370474 - 28370254
Alignment:
| Q |
23 |
ttgatttgaaacacaaattgatttgaaacgaaattgtgatctttgagttcccatatctttatactgatttgaattcacactgctgagagaaatttttgtt |
122 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||| |
|
|
| T |
28370474 |
ttgatttgaaacacaaattgattcgaaacgaaattgtgatctttgagttcccatatctttatactgatttgaattcacactgctgaaataaagttttgtt |
28370375 |
T |
 |
| Q |
123 |
ttgtgattgatgggatgcttcagtctgtatttcaattataattacaatgactgccttagtctatgaatgtaacactgacatttcagattgaatgcgtgtc |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28370374 |
ttgtgattgatgggatgcttcagtctgtatttcaattataattacaatgactgccttagtctatgaatgtaacactgacatttcagattgaatgcgtgtc |
28370275 |
T |
 |
| Q |
223 |
tcgtgtccaccactgcctttg |
243 |
Q |
| |
|
| ||||||||||||||||||| |
|
|
| T |
28370274 |
tggtgtccaccactgcctttg |
28370254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University