View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2092_low_28 (Length: 241)
Name: NF2092_low_28
Description: NF2092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2092_low_28 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 17 - 240
Target Start/End: Complemental strand, 31176266 - 31176038
Alignment:
| Q |
17 |
agttttgggtgtttgtgaagaagaatcgataggtttgtaaacttcatgttctcaaccata--atgaaataactattgtctttgggtgttactttttattt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31176266 |
agttttgggtgtttgtgaagaagaatcgataggtttgtaaacttcatgttctcaaccatataatgaaataactattgtctttgggtgttactttttattt |
31176167 |
T |
 |
| Q |
115 |
ttatctcggtaataggtacttatgtttt---atttggtttgataaaattgctagattaggtaatagggtgtatacttatgaagatattttgttttaagta |
211 |
Q |
| |
|
|||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
31176166 |
ttatctgggtaataggtacttatgtttttttatttggtttgataaaattgctagattaggtaatagggtgtatacttacgaagctattttgttttaagta |
31176067 |
T |
 |
| Q |
212 |
tatctttatgtattattgaccatgtatct |
240 |
Q |
| |
|
||||||||||||| ||||||||| ||||| |
|
|
| T |
31176066 |
tatctttatgtatcattgaccatatatct |
31176038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University