View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2092_low_7 (Length: 462)
Name: NF2092_low_7
Description: NF2092
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2092_low_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 339; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 339; E-Value: 0
Query Start/End: Original strand, 23 - 446
Target Start/End: Original strand, 7907074 - 7907505
Alignment:
| Q |
23 |
aaacattattaggacccaatcccaaaaggtaaaaagacacaactacatagtattaggctaaagaagacactatgtttgtctaactttatccactaaacnn |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7907074 |
aaacattattaggacccaatcccaaaaggtaaaaagacacaactacatagtattaggctaaagaagacactatgtttgtctaactttatccactaaacaa |
7907173 |
T |
 |
| Q |
123 |
nnnnnnnnnnnnnnn-----caacgttgtttgtgtctagctttattatcacctaacctaacgttccactaattacaagcaaacaaaacaaaaagatattg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7907174 |
aaaatatataaaaaaacaaccaacgttgtttgtgtctagctttattatcacctaacctaacgttccactaattacaagcaaacaaaacaaaaagatattg |
7907273 |
T |
 |
| Q |
218 |
caaaaatattaagatattaaagaggactcacatttgatttagtttggctcatcattgtaaccatttcattcagaaagtctcccatcccctgcaaaacaaa |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
7907274 |
caaaaatattaagatattaaagaggactcacatttgatttagtttggctcatcattgtaaccatttcattcagaaagtctcccataccctgcaaaacaaa |
7907373 |
T |
 |
| Q |
318 |
attcattttcttagattatagtacatcaaaattattggttcgagaatactcctctctatttgattgaaacaagattcaattccatgaattattgcctctt |
417 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7907374 |
attcattttcttagattatagcacatcaaaattattggttcgagaatactcctctctatttgattgaaacaagattcaattccatgaattattgcctctt |
7907473 |
T |
 |
| Q |
418 |
attgaaaacat---cacaacatgccacatgtg |
446 |
Q |
| |
|
||||||||||| |||||||||||||||||| |
|
|
| T |
7907474 |
attgaaaacatatacacaacatgccacatgtg |
7907505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University