View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20930_low_6 (Length: 265)
Name: NF20930_low_6
Description: NF20930
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20930_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 7 - 252
Target Start/End: Original strand, 1252299 - 1252547
Alignment:
| Q |
7 |
taagacccgtttattaaaatctagggaaaactacatttacctcccttgaggtttccccttaaacaaacgtttgttacttaaccccggccaccaccaaaaa |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
1252299 |
taagacccgtttattaaaatctagggaaaactacatttacctcccatgaggtttccccttaaacaaacgtttgttacttaaccccggccaccaacaaaaa |
1252398 |
T |
|
| Q |
107 |
taaattcacagctgaatttccaatgctagnnnnnnnnttaagatgttggtttgtcaaaagagaggttctataacatagatttctcatctttcacatagtt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
1252399 |
taaattcacagctgaatttccaatgctagaacgaaaattacgatgttggtttgtcaaaagagaggttctataacatagatttctcatgtttcacatagtt |
1252498 |
T |
|
| Q |
207 |
ttctggatctgt---cttcgtcagcttttcgattacgattttctctctc |
252 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
1252499 |
ttctggatctgtcgacttcgtcagcttttcgattacgattttctctctc |
1252547 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 32 - 60
Target Start/End: Original strand, 50135031 - 50135059
Alignment:
| Q |
32 |
gaaaactacatttacctcccttgaggttt |
60 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
50135031 |
gaaaactacatttacctcccttgaggttt |
50135059 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University