View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20933_low_5 (Length: 253)
Name: NF20933_low_5
Description: NF20933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20933_low_5 |
 | |
|
| [»] chr1 (2 HSPs) |
| |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 132 - 253
Target Start/End: Complemental strand, 45702207 - 45702086
Alignment:
| Q |
132 |
tattgactatctttagattcggtgttctaacttatcacccatacataaaggattttgtttatccaatatttggcgaccaatctcctttaaattcactgtg |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45702207 |
tattgactatctttagattcggtgttctaacttatcacccatacataaaggattttgtttatccaatatttggcgaccaatctcctttaaattcactgtg |
45702108 |
T |
|
| Q |
232 |
cagtcatgttcttctgggtatc |
253 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
45702107 |
cagtcatgttcttctgggtatc |
45702086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 45702323 - 45702288
Alignment:
| Q |
16 |
atcataaagaattgaaatgtttaccattcttgttat |
51 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45702323 |
atcataaagaattgaaatgtttacaattcttgttat |
45702288 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 57; Significance: 7e-24; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 145 - 253
Target Start/End: Complemental strand, 47440621 - 47440513
Alignment:
| Q |
145 |
tagattcggtgttctaacttatcacccatacataaaggattttgtttatccaatatttggcgaccaatctcctttaaattcactgtgcagtcatgttctt |
244 |
Q |
| |
|
|||||||||| || |||||||||||||||||| |||||||||||||| || |||||||| |||||||||| |||||||| |||| |||| |||||||| |
|
|
| T |
47440621 |
tagattcggtattttaacttatcacccatacacaaaggattttgtttctctaatatttgacgaccaatcttctttaaatccactttgcatgtatgttctt |
47440522 |
T |
|
| Q |
245 |
ctgggtatc |
253 |
Q |
| |
|
|||| |||| |
|
|
| T |
47440521 |
ctggatatc |
47440513 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University