View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20933_low_6 (Length: 237)
Name: NF20933_low_6
Description: NF20933
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20933_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 1 - 154
Target Start/End: Complemental strand, 37991743 - 37991590
Alignment:
| Q |
1 |
tataaatttatgaagtaaaactaccgtagaagttcccttgnnnnnnnnnnnnnnnnnnnattattgcttttgttggaccaatgaaaatttgccaagtcaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
37991743 |
tataaatttatgaagtaaaactaccgtagaagttcccttgttttttttgttttgtttttattattgtttttgttggaccaatcaaaatttgccaagtcaa |
37991644 |
T |
 |
| Q |
101 |
gagtggtgggaagggtgtacaatagaaggtgtgtctatttataattttccattt |
154 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
37991643 |
gagtggttggaagggtgtagaatagaaggtgtgtctatctataattttccattt |
37991590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 60 - 152
Target Start/End: Original strand, 26068195 - 26068287
Alignment:
| Q |
60 |
attattgcttttgttggaccaatgaaaatttgccaagtcaagagtggtgggaagggtgtacaatagaaggtgtgtctatttataattttccat |
152 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| ||| |||||||||||||||||| || || |||||||||| |||| ||| |||| |
|
|
| T |
26068195 |
attattgcttttattggaccaataaaaatttgccaaatcagaagtggtgggaagggtgtataaataaaagtgtgtctatctatactttcccat |
26068287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 60 - 119
Target Start/End: Complemental strand, 28975674 - 28975616
Alignment:
| Q |
60 |
attattgcttttgttggaccaatgaaaatttgccaagtcaagagtggtgggaagggtgta |
119 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
28975674 |
attattgcttttgttggaccaataaaagtttgccaagt-aagagtggtggaaagggtgta |
28975616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 60 - 119
Target Start/End: Original strand, 21274682 - 21274741
Alignment:
| Q |
60 |
attattgcttttgttggaccaatgaaaatttgccaagtcaagagtggtgggaagggtgta |
119 |
Q |
| |
|
|||||||||||| ||||| |||| |||||||||||| ||| ||||||||||| |||||| |
|
|
| T |
21274682 |
attattgcttttattggatcaataaaaatttgccaaatcagaagtggtgggaatggtgta |
21274741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 60 - 119
Target Start/End: Original strand, 6378689 - 6378747
Alignment:
| Q |
60 |
attattgcttttgttggaccaatgaaaatttgccaagtcaagagtggtgggaagggtgta |
119 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
6378689 |
attattgcttttgttggaccaataaaagtttgccaagt-aagaatggtgggaagggtgta |
6378747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 60 - 119
Target Start/End: Complemental strand, 48817647 - 48817588
Alignment:
| Q |
60 |
attattgcttttgttggaccaatgaaaatttgccaagtcaagagtggtgggaagggtgta |
119 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||||| ||| |||||||||||||||||| |
|
|
| T |
48817647 |
attattgcttttattggaccaataaaaatttgccaaatcagaagtggtgggaagggtgta |
48817588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University