View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20934_high_15 (Length: 236)
Name: NF20934_high_15
Description: NF20934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20934_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 39383386 - 39383604
Alignment:
| Q |
1 |
caactaagttttgttgtctaagtttccctcgatctttaaccacactcgttcattaaaataaatttaatttatatattgataaaaataatattctctttca |
100 |
Q |
| |
|
|||||||||| | ||||||||||| ||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39383386 |
caactaagttgcgatgtctaagttttccttgatgtttaaccacactcgttcattaaaataaatttaatttatatattgataaaaataatattctctttca |
39383485 |
T |
 |
| Q |
101 |
caaatttattgatcnnnnnnncatattcgtgtataggggccgttacaaggatagaatgcgaagctgccgatgaatatggctttgaaacaaaaccattctc |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39383486 |
caaatttattgatcaaaaaaacatattcgtgtataggggccgttacaaggatagaatgcgaagctgccgatgaatatggctttgaaacaaaaccattctc |
39383585 |
T |
 |
| Q |
201 |
tttcttaaatgatgcaacc |
219 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
39383586 |
tttcttaaatgatgcaacc |
39383604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University