View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20934_low_10 (Length: 343)
Name: NF20934_low_10
Description: NF20934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20934_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 7 - 333
Target Start/End: Original strand, 32171561 - 32171884
Alignment:
| Q |
7 |
gaatgttcaaaatttacagcgtaacttcatttggggtcaagaggaagcttcatttggttaagtgggacacaatgttgttgcataatttgcgtggtggttt |
106 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||| ||||||||| |
|
|
| T |
32171561 |
gaatattcaaaatttacagcgtaacttcatttggggtcaagaggaagcttcacttggttaagtgggacacaatgtt---gcataatttgcatggtggttt |
32171657 |
T |
|
| Q |
107 |
agctatttggtgtccacctactatgaattgtgcttgtttagtgaagatgggttgggagatgaaggagaggtaaatgtatagcttgtggtgcagtgttctg |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32171658 |
agctatttggtgtccacctactatgaattgtgcttgtttagtgaagatgggttgggagatgaaggagaggtaaatgtatagcttgtggtgcagtgttctg |
32171757 |
T |
|
| Q |
207 |
aaaggtaaacatgggtgtgggatgattgataatggttccattattgctaaatccacattttcctttattgaagtgattacttcttggtcgtatatcactc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
32171758 |
aaaggtaaacatgggtgtgggatgattgataatggttccattattgctaaacccacattttcctttattgaagtgattacttcttggtcgtatatcacac |
32171857 |
T |
|
| Q |
307 |
tttttgaagagtgggctattgatgatg |
333 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
32171858 |
tttttgaagagtgggctattggtgatg |
32171884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University