View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20934_low_13 (Length: 250)
Name: NF20934_low_13
Description: NF20934
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20934_low_13 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 16 - 250
Target Start/End: Complemental strand, 48467032 - 48466798
Alignment:
| Q |
16 |
atgttgtcgatatgcatattttagtagttaatgtgatatctagtttaggtcgtgtaagattttttagatcaaacagagaaaattaggttctatacatgct |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48467032 |
atgttgtcgatatgcatattttagtagttaatgtgatatctagtttaggtcgtgtaagattttttagatcaaacagagaaaattaggttctatacatgct |
48466933 |
T |
|
| Q |
116 |
aatatgatgtgctcatcaccctgtttaagcattgatagtgtggaaattttgggactatatcaagcaatgtcacagatgatgcatagttttcactcttgta |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48466932 |
aatatgatgtgctcatcaccctgtttaagcattgataatgtggaaattttgggactatatcaagcaatgtcacagatgatgcatagttttcactcttgta |
48466833 |
T |
|
| Q |
216 |
aagaaattgtttctcagttcgatcggttacgtctt |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
48466832 |
aagaaattgtttctcagttcgatcggttacgtctt |
48466798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 20 - 113
Target Start/End: Complemental strand, 48475984 - 48475891
Alignment:
| Q |
20 |
tgtcgatatgcatattttagtagttaatgtgatatctagtttaggtcgtgtaagattttttagatcaaacagagaaaattaggttctatacatg |
113 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||| ||||||||| | || |||||||||||||||||||||||||| ||||||| |
|
|
| T |
48475984 |
tgtcgataagcatattttagctcttaatgtgatatctagtttaagtcgtgtaacacttcttagatcaaacagagaaaattaggtttaatacatg |
48475891 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University