View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20935_high_13 (Length: 253)
Name: NF20935_high_13
Description: NF20935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20935_high_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 1 - 135
Target Start/End: Complemental strand, 2833112 - 2832978
Alignment:
| Q |
1 |
tgtttcttttgttgtttttgctgctttaaagtagttttgggtgcacctccgaccccgtctgtggggttggggcgttatcctaggtggtggtttgttggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2833112 |
tgtttcttttgttgtttttgctgctttaaagtagttttgggtgcgcctccgaccctgtctgtgggattggggcgttatcctaggtggtggtttgttggag |
2833013 |
T |
|
| Q |
101 |
tgtcgttttgacggctatatggtgtattgtacatc |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
2833012 |
tgtcgttttgacggctatatggtgtattgtacatc |
2832978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 167 - 244
Target Start/End: Complemental strand, 2832946 - 2832867
Alignment:
| Q |
167 |
gccatacaaaagaagaagaaaaa--tgagtcgacggcttgccaattggacccatctaagctgtaaattccttcatctctg |
244 |
Q |
| |
|
||||||||||||||||| ||||| |||||| ||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2832946 |
gccatacaaaagaagaaaaaaaaaatgagtctacgccttgccaattggacccatctaagctgtaaattccttcatctctg |
2832867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University