View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20935_high_16 (Length: 236)

Name: NF20935_high_16
Description: NF20935
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20935_high_16
NF20935_high_16
[»] chr2 (2 HSPs)
chr2 (167-221)||(30261338-30261392)
chr2 (175-221)||(29446852-29446898)


Alignment Details
Target: chr2 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 167 - 221
Target Start/End: Original strand, 30261338 - 30261392
Alignment:
167 taagtaaagttacagttggctaaaagaaattatatacatttggtgaacccctttg 221  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
30261338 taagtaaagttacagttggctaaaagaaattatatacatttggtgaacccatttg 30261392  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 175 - 221
Target Start/End: Complemental strand, 29446898 - 29446852
Alignment:
175 gttacagttggctaaaagaaattatatacatttggtgaacccctttg 221  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||    
29446898 gttacagttggctaaaagaaattatatacatttggtgaacccatttg 29446852  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University