View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20936_high_14 (Length: 277)
Name: NF20936_high_14
Description: NF20936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20936_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 17 - 272
Target Start/End: Original strand, 32330582 - 32330837
Alignment:
| Q |
17 |
gtactttcaccgcgtaactgtctcacgtgccgtaccttcccatactcatcttccaccgccgaatcaaaaactccgacaattctgcacccccaaatgccgc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||| ||||| |
|
|
| T |
32330582 |
gtactttcaccgcgtaactgtctcacgtgccgtaccttcccatactcatcttccaccgccgaatcaaaaactccgacaattccgcaccgccaaacgccgc |
32330681 |
T |
 |
| Q |
117 |
cgtgtcaacctctccatcaccgcagctaagaaaaccgagcaccacgacggtaacaacggcgtcgagcgaacagaatgttctccagcacgaagcaaccggc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32330682 |
cgtgtcaacctctccatcaccgcagctaagaaaaccgagcaccacgacggtaacaacggcgtcgagcgaacagaatgttctccagcacgaagcaaccggc |
32330781 |
T |
 |
| Q |
217 |
gaggagtgttgatggcgccgtttctagccgccggagcttcgtttcttctctctgct |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32330782 |
gaggagtgttgatggcgccgtttctagccgccggagcttcgtttcttctctctgct |
32330837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University