View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20936_high_29 (Length: 236)
Name: NF20936_high_29
Description: NF20936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20936_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 24787975 - 24788195
Alignment:
| Q |
1 |
tctagtggattaaggggatttggttggtgttgtggttatctttcaggtttttggctcatggcgtcactttagggtgggtttgatcttagtttagcagttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24787975 |
tctagtggattaaggggatttggttggtgttgtcattatctttcaggtttttggttcatggtgtcactttagggtgggtttgatcttagtttagcagttc |
24788074 |
T |
|
| Q |
101 |
gttgtatggtcaatttgaaaagatggcggaaatggcaaaacattcatcttcgaagtggtttcaagataagtgttttggtatttcttgtacatattatttg |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24788075 |
gttgtaaggtcaatttgaaaagatggcggaaatggcgaaacactcatcttcgaagtagttttaagataagtgtttcggtatttcttgtacatattatttg |
24788174 |
T |
|
| Q |
201 |
gtcgaaagtgacccatgtttt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24788175 |
gtcgaaagtgacccatgtttt |
24788195 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 24820286 - 24820066
Alignment:
| Q |
1 |
tctagtggattaaggggatttggttggtgttgtggttatctttcaggtttttggctcatggcgtcactttagggtgggtttgatcttagtttagcagttc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24820286 |
tctagtggattaaggggatttggttggtgttgtcattatctttcaggtttttggttcatggtgtcactttagggtgggtttgatcttagtttagcagttc |
24820187 |
T |
|
| Q |
101 |
gttgtatggtcaatttgaaaagatggcggaaatggcaaaacattcatcttcgaagtggtttcaagataagtgttttggtatttcttgtacatattatttg |
200 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||| ||||||||||||| |||| ||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
24820186 |
gttgtaaggtcaatttgaaaagatggcggaaatggcgaaacactcatcttcgaagtagttttaagataagtgtttcggtatttcttgtacatattatttg |
24820087 |
T |
|
| Q |
201 |
gtcgaaagtgacccatgtttt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
24820086 |
gtcgaaagtgacccatgtttt |
24820066 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University