View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20936_high_7 (Length: 429)
Name: NF20936_high_7
Description: NF20936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20936_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 331; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 331; E-Value: 0
Query Start/End: Original strand, 19 - 419
Target Start/End: Complemental strand, 3639136 - 3638740
Alignment:
| Q |
19 |
catttagtatttagtttagatgagttgggtggtctcgactcgagagtagtagtaacttgtaacagtcatgcttgagttagaag---ttgggggaaaattg |
115 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
3639136 |
catttagtatttagtttagatgagtcgggtggtctcga-----gagtagtagtaactagtaacagtcatgcttgagttagaagaagttgggggaaaattg |
3639042 |
T |
 |
| Q |
116 |
catttttccctccaacccggaatgtatttgggttataaaatcgtccgggtcgtgtgtgtttaaacgggtcggtccggtttattatgcaaataaaattacc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3639041 |
tatttttccctccaacccggaatgtatttgggttataaaatcgtccgggtcgtgtgt--ttaaacgggtcggtccggtttattatgcaaataaaattacc |
3638944 |
T |
 |
| Q |
216 |
cggttttgtttccaaaaacacttttgcctcctaagttcatagcttcttcaatcacctctcgtacactgtacgagattcttagtgcaattcgattttgctc |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
3638943 |
cggttttgtttccaaaaacacttttgcctcctaagttcatagcttcttcaattacctctcgtacactgtacgagattcttagtacaattcgattttgctc |
3638844 |
T |
 |
| Q |
316 |
atttgaactcttgtattcgtttttgtgtgccagtagcgtgtgattctgtgaaatttgttggatagtttgattcaggagaaaaggtttgtagttttatgcc |
415 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3638843 |
atttaaactcttgtattcgtttttgtctgccagtagcgtgtgattctgtgaaatttgttggatagtttgattcaggagaaaaggtttgtagttttatgcc |
3638744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University