View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20936_low_13 (Length: 298)
Name: NF20936_low_13
Description: NF20936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20936_low_13 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 112 - 293
Target Start/End: Complemental strand, 34797762 - 34797581
Alignment:
| Q |
112 |
tagatttctgaaaaggtaaactttcaagaatctattgatccaatatannnnnnnnnaaaacaaatacaaacagccagccaaaacagataatagagatctg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34797762 |
tagatttctgaaaaggtaaactttcaagaatctattgatccaatatatttttttttaaaacaaatacaaacagccagccaaaacagataatagagatctg |
34797663 |
T |
 |
| Q |
212 |
tacacataaacaaagaacttgcagataaccatgcatatcagttcggatcaaaacatcgtctgacaagaacaattatgctttt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34797662 |
tacacataaacaaagaacttgcagataaccatgcatatcagttcggatcaaaacatcgtctgacaagaacaattatgctttt |
34797581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University