View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20936_low_17 (Length: 265)
Name: NF20936_low_17
Description: NF20936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20936_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 8 - 248
Target Start/End: Original strand, 35428648 - 35428888
Alignment:
| Q |
8 |
agattattctatgcctgggatgacaggatatgaattgctcaaaaagattaaggtgtgaatttttcttgttatgtttttgttttcagagattagtgatgta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35428648 |
agattattctatgcctgggatgacaggatatgaattgctcaaaaagattaaggtgtgaatttttcttgttatgtttttgttttcagagattagtgatgta |
35428747 |
T |
|
| Q |
108 |
tatattgatgaaagaggaataatcctgattagattagattgtagtgtatgaaattttattgatcttgttattaatcttttcttatttctgttaatttcag |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35428748 |
tatattgatgaaagaggaataatcctgattagattagattgtagtgtatgaaattttattgatcttgttattaatcttttcttatttctgttaatttcag |
35428847 |
T |
|
| Q |
208 |
caggaatcatctgtttttagagaaattccagtggtggttat |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35428848 |
caggaatcatctgtttttagagaaattccagtggtggttat |
35428888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 196 - 243
Target Start/End: Original strand, 44213613 - 44213660
Alignment:
| Q |
196 |
tgttaatttcagcaggaatcatctgtttttagagaaattccagtggtg |
243 |
Q |
| |
|
||||||||||||||||| || |||||||||||||| |||||||||||| |
|
|
| T |
44213613 |
tgttaatttcagcaggagtcttctgtttttagagagattccagtggtg |
44213660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 9 - 62
Target Start/End: Original strand, 44213434 - 44213487
Alignment:
| Q |
9 |
gattattctatgcctgggatgacaggatatgaattgctcaaaaagattaaggtg |
62 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| ||||| || || |||||| |
|
|
| T |
44213434 |
gattattccatgcctgggatgacaggatatgaattactcaagaaaatcaaggtg |
44213487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University