View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20936_low_24 (Length: 245)
Name: NF20936_low_24
Description: NF20936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20936_low_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 19 - 226
Target Start/End: Complemental strand, 26921473 - 26921266
Alignment:
| Q |
19 |
aacaagagcgaaaattaaaacacaaccagagaatcatttcgcctcctatcaagatcaatcaacctcagtcgaacaggacgaagactaggaacaagctaca |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26921473 |
aacaagagcgaaaattaaaacacaaccagagaatcatttcgcctcctatcaagatcaatcaacctcagtcgaacaggacgaagactaggaacaagctaca |
26921374 |
T |
 |
| Q |
119 |
gagtcgaccaacccctagacaaatccgcaacatgacattgcacttttaataccctacctgaccaaatactaccatttccatccgtaatgttgtttggtgt |
218 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26921373 |
gagtcgaccaacccctagacaaatccgcagcatgacattgcaaatttaataccctacctgaccaaatactaccatttccatccgtaatgttgtttggtgt |
26921274 |
T |
 |
| Q |
219 |
gaactctg |
226 |
Q |
| |
|
|||||||| |
|
|
| T |
26921273 |
gaactctg |
26921266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University