View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20936_low_27 (Length: 238)
Name: NF20936_low_27
Description: NF20936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20936_low_27 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 6448732 - 6448512
Alignment:
| Q |
18 |
gaaacaaaaggcaattcttgaacacaaatgtcagtttggccttaaacaaacatgatgtatttgctgtcaaaagtacgtgcttaaatttaactacatatga |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6448732 |
gaaacaaaaggcaattcttgaacacaaatgtcagtttggccttaaacaaacatgatgtatttgctgtcaaaagtacgtgcttaaatttaactacatatga |
6448633 |
T |
 |
| Q |
118 |
gtggatttgacttatgttgcttgatgaacgaaggcttctaat-ttttagtcaatttgtttatttaagggaacttttaatgcaaaacaactattttatctc |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6448632 |
gtggatttgacttatgttgcttgatgaacgaaggcttctaattttttagtcaatttgtttatttaagggaa-ttttaatgcaaaacaactattttatctc |
6448534 |
T |
 |
| Q |
217 |
aacttcaagtggctagaactgc |
238 |
Q |
| |
|
||| |||||||||||||||||| |
|
|
| T |
6448533 |
aacctcaagtggctagaactgc |
6448512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University