View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20936_low_29 (Length: 237)
Name: NF20936_low_29
Description: NF20936
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20936_low_29 |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0002 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 5891 - 5671
Alignment:
| Q |
1 |
tatattgaaaagtgaaataagtcacttattttggttgcaagtgactcggatattttggaatggaaggggtattagtgatgggatggtggattcatcatta |
100 |
Q |
| |
|
|||||| |||||| |||| |||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
5891 |
tatattaaaaagtcaaatgagtcacttattttgattgcaagtgactcggatattttggaatggaaagggtattagtgatgggatggtggattcatcatta |
5792 |
T |
 |
| Q |
101 |
agatatatagatatatttgggtcgcttttgcatgaatttagtgtagaaaaccaatcttgccaaatctagggtttaattttccaaaaatgtcacttttact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5791 |
agatatatagatatatttgggtcgcttttgcatgaattcagtgtagaaaaccaatcttgccaaatctagggtttaattttccaaaaatgtcacttttact |
5692 |
T |
 |
| Q |
201 |
catgcatttttatttagtaat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
5691 |
catgcatttttatttagtaat |
5671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University