View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20937_high_10 (Length: 236)
Name: NF20937_high_10
Description: NF20937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20937_high_10 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 4473898 - 4474117
Alignment:
| Q |
16 |
cttttgtcaaaaccctggctgtgtagtaatttaagatattaagattatggtaatcgggataaaatgttgccgcgttggactagagataccaaaaacctta |
115 |
Q |
| |
|
||||||||||||||| ||| || |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4473898 |
cttttgtcaaaacccaggc-gtatagtaatttaagatcttaagattatggtaatcgggataaaatgttgccgcgttggactagagataccaaaaacctta |
4473996 |
T |
 |
| Q |
116 |
ataccgcgactcaaattgcaattgcaagccttttttaaaagtcatgtactattgtaactatgatctatttatctatctagcatataaaattactaaaacc |
215 |
Q |
| |
|
||| ||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4473997 |
atatcgcgactcaaattgcaattgcaaacctttcttaaaagtcatgtactattgtaactatgatctatttatctatctagcatataaaattactaaaacc |
4474096 |
T |
 |
| Q |
216 |
atatctcctgtttttgtttct |
236 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
4474097 |
atatcttttgtttttgtttct |
4474117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University