View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20937_high_6 (Length: 257)
Name: NF20937_high_6
Description: NF20937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20937_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 252
Target Start/End: Original strand, 53267749 - 53268001
Alignment:
| Q |
1 |
taatatggttattgttacaggcttacaggtagatttaaatattattgataagcaacaaaatatcatgatctttcatgtaggtgccataaatagtcattac |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267749 |
taatatggttattgttacaggcttacaggtagatttaaatatt---gataagcaacaaaatatcatgatctttcatgtaggtgccataaatagtcattac |
53267845 |
T |
|
| Q |
101 |
ctacttc----cattgaacatattataaatttgatatgatgctcactagacacgtaaacatatttatttgatccaatcgttgagtttgttatttcagttc |
196 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267846 |
ctacttccttccattgaacacattataaatttgatatgatgctcactagacacgtaaacatatttatttgatccaatcgttgagtttgttatttcagttc |
53267945 |
T |
|
| Q |
197 |
taatttaatcgaagatttttctaaacacatttgttgctatactatctgatcctttg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53267946 |
taatttaatcgaagatttttctaaacacatttgttgctatactatctgatcctttg |
53268001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University