View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20937_low_12 (Length: 236)

Name: NF20937_low_12
Description: NF20937
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20937_low_12
NF20937_low_12
[»] chr1 (1 HSPs)
chr1 (16-236)||(4473898-4474117)


Alignment Details
Target: chr1 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 16 - 236
Target Start/End: Original strand, 4473898 - 4474117
Alignment:
16 cttttgtcaaaaccctggctgtgtagtaatttaagatattaagattatggtaatcgggataaaatgttgccgcgttggactagagataccaaaaacctta 115  Q
    ||||||||||||||| ||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4473898 cttttgtcaaaacccaggc-gtatagtaatttaagatcttaagattatggtaatcgggataaaatgttgccgcgttggactagagataccaaaaacctta 4473996  T
116 ataccgcgactcaaattgcaattgcaagccttttttaaaagtcatgtactattgtaactatgatctatttatctatctagcatataaaattactaaaacc 215  Q
    ||| ||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4473997 atatcgcgactcaaattgcaattgcaaacctttcttaaaagtcatgtactattgtaactatgatctatttatctatctagcatataaaattactaaaacc 4474096  T
216 atatctcctgtttttgtttct 236  Q
    ||||||  |||||||||||||    
4474097 atatcttttgtttttgtttct 4474117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University