View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20938_high_14 (Length: 289)
Name: NF20938_high_14
Description: NF20938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20938_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 273
Target Start/End: Complemental strand, 14435730 - 14435470
Alignment:
| Q |
13 |
gaaggacaaaccaaacctttggatgatataaccatcatcattgacaaccacagtctcctccaagagtttcagcctatgattatgggaagtgaccctcgta |
112 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14435730 |
gaaggagaaaccaaacctttggatgatataaccatcatgattgacaaccacagtctcctcccagagtttcagcctatgattatgggaagtgaccctcgta |
14435631 |
T |
 |
| Q |
113 |
gaacgatcatttggtaaaaccttgaaattagagatcaagtaaacacggttctcgtgaaaagtattctggaaacgatcaacacagtctggaggaattgttg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14435630 |
gaacgatcatttggtaaaaccttgaaattagagaacatgtaaacacggttctcatgaaaagtattctggaaacgatcaacacagtctggaggaattgttg |
14435531 |
T |
 |
| Q |
213 |
catggatcctagtcccctgcaatagtgccataaccatgcaaaaaagttccaaacaacaaag |
273 |
Q |
| |
|
| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14435530 |
cttggatcctattcccctgcaatagtgccataaccatgcaaaaaagttccaaacaacaaag |
14435470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University