View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20938_high_19 (Length: 242)
Name: NF20938_high_19
Description: NF20938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20938_high_19 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 81 - 230
Target Start/End: Original strand, 11743016 - 11743165
Alignment:
| Q |
81 |
ttctccttgatcttacatgatgtgtgtatccatcccttcttgatcatattaacttcttgcggccaaaaatgaagtttctgaatgagtccgtacactgcac |
180 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11743016 |
ttctccttcatcttgcatgatgtgtgtatccatccctccttgatcatattaacttcttgcggccaaaaatgaagtttctgaatgagtccgtacactgcac |
11743115 |
T |
 |
| Q |
181 |
aagtcaataaatgcaccttccatttccattaatgctttcttttcatctca |
230 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11743116 |
aagtcaataaatgcaccttccatttccattaatgctttcttttcatctca |
11743165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University