View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20938_low_15 (Length: 259)
Name: NF20938_low_15
Description: NF20938
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20938_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 67 - 251
Target Start/End: Original strand, 49553086 - 49553268
Alignment:
| Q |
67 |
tcattgtaaatacatgaaactcaagcattgactacgactgtgctcttttaaacaggacattatattttcccaagcagaacacattctagattgtgcatga |
166 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49553086 |
tcattgtaaatacatgaaactcaagcattgactacgaccgtgct--tttaaataggacattatatcttcccaagcagaacacattctagattgtgcatga |
49553183 |
T |
 |
| Q |
167 |
aaacatcgatgaagagatagagggggtccagaacaatgagagatgggcttatgtgaaggttacattggacaaaaatgttcttctc |
251 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||| ||||||||||||||| |
|
|
| T |
49553184 |
aaacttcgatgaagagatagagggggtccagaacaatgagagatggggttatgtgaaggttaacatggagaaaaatgttcttctc |
49553268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 149 - 228
Target Start/End: Original strand, 49538498 - 49538578
Alignment:
| Q |
149 |
attctagat-tgtgcatgaaaacatcgatgaagagatagagggggtccagaacaatgagagatgggcttatgtgaaggtta |
228 |
Q |
| |
|
||||||||| ||| ||||||||| | ||||||||||||||||| || |||| ||||||||||||||||||||||||||||| |
|
|
| T |
49538498 |
attctagatctgtccatgaaaactttgatgaagagatagagggagtacagagcaatgagagatgggcttatgtgaaggtta |
49538578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University