View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20939_high_7 (Length: 280)
Name: NF20939_high_7
Description: NF20939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20939_high_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 187 - 273
Target Start/End: Complemental strand, 11134484 - 11134398
Alignment:
| Q |
187 |
gttatatacatttcatcttgataataattccacaaaccctaccctaccctaaaacaaaaaataacttagaaagaagaagtataatct |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11134484 |
gttatatacatttcatcttgataataattccacaaaccctaccctaccctaaaacaaaaaataacttagaaagaagaagtataatct |
11134398 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 72 - 154
Target Start/End: Complemental strand, 11134599 - 11134517
Alignment:
| Q |
72 |
gtttgttttcttttaagaaacgtaaaggatgcacatccaacaactacatgaatnnnnnnngtaacaaatgcaatcgtacaaaa |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11134599 |
gtttgttttcttttaagaaacgtaaaggatgcacatccaacaactacatgaataaaaaaagtaacaaatgcaatcgtacaaaa |
11134517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University