View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20939_high_9 (Length: 250)
Name: NF20939_high_9
Description: NF20939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20939_high_9 |
 |  |
|
| [»] chr5 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 106; Significance: 4e-53; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 106; E-Value: 4e-53
Query Start/End: Original strand, 137 - 250
Target Start/End: Original strand, 27780900 - 27781013
Alignment:
| Q |
137 |
tttaagaatatgaatctctacaaatcgaggctagtatttagtattttgcatcaagtattgtcaagttattttcgatactattcaagctcttactatttct |
236 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27780900 |
tttaagaatatgaatctctacaaattgaggctagtatttagtattttgcatcaagtattgtcaagttattttcgataatattcaagctcttactatttct |
27780999 |
T |
 |
| Q |
237 |
ctcttatataaaac |
250 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
27781000 |
ctcttatataaaac |
27781013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 35 - 140
Target Start/End: Original strand, 27794069 - 27794164
Alignment:
| Q |
35 |
catgtcattttcctattttagttttaaaactatctatgtggtaaaacattatagaatacatgtgtgaaactattttactcgcataccaattaaattgaac |
134 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27794069 |
catgtcattttcctattttagttttaaaactatctatgt----------tatagaatacatgtgtgaaactattttacttgcataccaattaaattgaac |
27794158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University