View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20939_low_11 (Length: 240)
Name: NF20939_low_11
Description: NF20939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20939_low_11 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 240
Target Start/End: Original strand, 32171925 - 32172162
Alignment:
| Q |
1 |
tccaacttgcgtagctgatagcattgagaaaatttatcacggcacgagccattgtaaagtgcctgatttggtttgatattgatggtaattggaaggtgat |
100 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32171925 |
tccaacttgcgtagctgataggatagagaaaatttatcacggcacgatccattgtaaagtgcctgatttggtttgatattgatggtaattggaaggtgat |
32172024 |
T |
 |
| Q |
101 |
cactttgttgaacttgttactgtcggctctggttgagaggctgatattgatgggagtgatgattgtgtggatgttagagcatggtcgggaaataggcttg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32172025 |
cactttgttgaacttgttactgtcggctctggttgagaggctgatattgatggtagtgatgattgtgtggatgttagagcatggtcgggaaataggcttg |
32172124 |
T |
 |
| Q |
201 |
gtaannnnnnnatgtctcgaatgcctacaatattcttcga |
240 |
Q |
| |
|
|||| | |||||||||||||||||||| |||||| |
|
|
| T |
32172125 |
gtaa--tttttacgtctcgaatgcctacaatatgcttcga |
32172162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University