View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20939_low_20 (Length: 205)
Name: NF20939_low_20
Description: NF20939
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20939_low_20 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 19 - 205
Target Start/End: Complemental strand, 42470520 - 42470338
Alignment:
| Q |
19 |
tgatatacatgcctctgtttgtttctgcggtgggatagcattagacgcgcgtctaacatgaaatcacagtgtctagcttggaaataattggcaaacacta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42470520 |
tgatatacatgcctctgtttgtttctgcagtgggatagcattagacgcgcgtctaacatgaaatcacagtgtctagcttggaaataattggcaaacacta |
42470421 |
T |
 |
| Q |
119 |
aacttaattaacatataaatatatnnnnnnncacacctgtgtattatttctaacactcatgtagagcacagatagtggtccaatgtt |
205 |
Q |
| |
|
||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42470420 |
aac----ttaacatataaatatataaaaaaacacacctgtgtattatttctaacactcatgtagagcacagatagtggtccaatgtt |
42470338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University