View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2093_high_11 (Length: 227)
Name: NF2093_high_11
Description: NF2093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2093_high_11 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 1 - 137
Target Start/End: Complemental strand, 24850225 - 24850089
Alignment:
| Q |
1 |
ccagaatcagctgtgtttctactaatttttgaattttgacaaataaatttacttagatcagttactatgttgtatcagatcaaggtagcatgnnnnnnna |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
24850225 |
ccagaatcagctgtgtttctactaatttttgaattttgacaaataaatttacttagatcagttactatgttgtatcagatcaaggtagcatgttttttta |
24850126 |
T |
|
| Q |
101 |
gaggatctgcaaggtagcatgttcctttggttcttgc |
137 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24850125 |
gaggatctgcaaggtagcatgttcctttggttcttgc |
24850089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University