View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2093_high_12 (Length: 219)
Name: NF2093_high_12
Description: NF2093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2093_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 11 - 201
Target Start/End: Complemental strand, 52114613 - 52114423
Alignment:
| Q |
11 |
gcataggaagaggatactgtagcaggaacaatgtagatttaaagataggactttgaaatttggtcggtttgaggatgatttgggttgtggatgctgaatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52114613 |
gcataggaagaggatactgtagcaggaacaatgtagatttaaagataggattttgaaatttggtcggtttgaggatgatttgggttgtggatgctgaatt |
52114514 |
T |
|
| Q |
111 |
cttttggagacaacagtttagactttagactaacgctattgtccccatggtatattattgatttgttgtacaatgacaggaaggtggtatc |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52114513 |
cttttggagacaacagtttagactttagactaacgctattgtccccatggtatattattgatttgttgtacaatgacaggaaggtggtatc |
52114423 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University