View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2093_high_8 (Length: 283)
Name: NF2093_high_8
Description: NF2093
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2093_high_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 16 - 281
Target Start/End: Complemental strand, 40473568 - 40473303
Alignment:
| Q |
16 |
cattattcgtcaacaaggtcctctttgcctttataagggcttgtctccagcaattttaagacacctattctacacgcctattcgaattgttgggtatgag |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40473568 |
cattattcgtcaacaaggtcctctttgcctttataagggcttgtctccagcaattttaagacacctattctacacccctattcgaattgttgggtatgag |
40473469 |
T |
|
| Q |
116 |
cacctgaggagtgttatttcttctgataatgggtcgccctctatcattggcaaggctgttgttggtggaatctctggcagtatggctcaggtgagaatat |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40473468 |
cacctgaggagtgttatttcttctgataatgggtcgccctctatcattggcaaggctgttgttggtggaatctctggcagtatggctcaggtgagaatat |
40473369 |
T |
|
| Q |
216 |
ttgtgcagaattcttgtcaatttctcatagtaagtacatagttcagatttgtaattcaaattttct |
281 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||| ||| || |||||||||||||||||||||| |
|
|
| T |
40473368 |
ttgttcagaattcttgtcaatttctcatagtaagtaaataattaagatttgtaattcaaattttct |
40473303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University