View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20940_high_11 (Length: 226)
Name: NF20940_high_11
Description: NF20940
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20940_high_11 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 208
Target Start/End: Original strand, 36636276 - 36636468
Alignment:
| Q |
17 |
catagggtgctaatatatgagtacatggccagaggaagtgtggaacacaatttgttctcaagtaagtatatactatcccacttgatattgaaattcttac |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36636276 |
catagggtgctaatatatgagtacatggccagaggaagtgtggaacacaatttgttctcaagtaagtatatactatcccacttgatattgaaattcttac |
36636375 |
T |
 |
| Q |
117 |
attctattgatattaaagcttaggatagaacatgttagtaaggtaacaacacatagtt-cttaagtataatttagacgaccggaacatttgat |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| ||||||||||||||||| |||||||||| |
|
|
| T |
36636376 |
attctattgatattaaagcttaggatagaacatgttagtaaggtaacaacacatagttccctaactataatttagacgaccgaaacatttgat |
36636468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University