View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20942_high_14 (Length: 273)
Name: NF20942_high_14
Description: NF20942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20942_high_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 8 - 259
Target Start/End: Complemental strand, 29280700 - 29280449
Alignment:
| Q |
8 |
tgagatgaaggaatgggaacagatgctgatgtctttgcctcatgagactttggttaggttatttatcattccgatgaagtcgttggttttgtctgttaaa |
107 |
Q |
| |
|
|||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280700 |
tgagttgaaggaatgtgaacagatgctgatgtctttgcctcatgagactttggttaggttatttatcattccgatgaagtcgttggttttgtctgttaaa |
29280601 |
T |
 |
| Q |
108 |
gaggacggtaatggtgctggttttggtgatcgtggatcggaagaagaaaaaagaaaaggtgtagatggtgagaatgaaaaggttgatgatgtgtatgaat |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280600 |
gaggacggtaatggtgctggttttggtgattgtggatcggaagaagaaaaaagaaaaggtgtagatggtgagaatgaaaaggttgatgatgtgtatgaat |
29280501 |
T |
 |
| Q |
208 |
ttggaatcaagtgtttgaagaagctttgtgttgcatttggaggggacaaagt |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29280500 |
ttggaatcaagtgtttgaagaagctttgtgttgcatttggaggggacaaagt |
29280449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University