View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20942_high_19 (Length: 240)
Name: NF20942_high_19
Description: NF20942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20942_high_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 1906738 - 1906528
Alignment:
| Q |
20 |
tattttaggttcacacgagtacattgaagtgattgcaagcacaacaacaaggaagaaacaagtaagatttctgattgaattggaattgaaagagcagttc |
119 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1906738 |
tattttaggttcacacgaatacattgaagtgattgcaagcacaacaacaaggaagaaacaagtaagatttctgattgaattggaattgaaagagcagttc |
1906639 |
T |
 |
| Q |
120 |
cagattgcaaaagcaggtgaagaataccagaaacttgtgtcttgtttgcctgaattttatgtcgggaagccagagtacttaaccgcgattgttcgacttg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1906638 |
cagattgcaaaagcaggtgaagaataccagaaacttgtgtcttgtttgcctgaattttatgtcgggaagccagagtacttaaccgcgattgttcgacttg |
1906539 |
T |
 |
| Q |
220 |
tctgtgctgct |
230 |
Q |
| |
|
| |||| |||| |
|
|
| T |
1906538 |
tgtgtgatgct |
1906528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University