View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20942_high_19 (Length: 240)

Name: NF20942_high_19
Description: NF20942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20942_high_19
NF20942_high_19
[»] chr5 (1 HSPs)
chr5 (20-230)||(1906528-1906738)


Alignment Details
Target: chr5 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 230
Target Start/End: Complemental strand, 1906738 - 1906528
Alignment:
20 tattttaggttcacacgagtacattgaagtgattgcaagcacaacaacaaggaagaaacaagtaagatttctgattgaattggaattgaaagagcagttc 119  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1906738 tattttaggttcacacgaatacattgaagtgattgcaagcacaacaacaaggaagaaacaagtaagatttctgattgaattggaattgaaagagcagttc 1906639  T
120 cagattgcaaaagcaggtgaagaataccagaaacttgtgtcttgtttgcctgaattttatgtcgggaagccagagtacttaaccgcgattgttcgacttg 219  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1906638 cagattgcaaaagcaggtgaagaataccagaaacttgtgtcttgtttgcctgaattttatgtcgggaagccagagtacttaaccgcgattgttcgacttg 1906539  T
220 tctgtgctgct 230  Q
    | |||| ||||    
1906538 tgtgtgatgct 1906528  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University