View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20942_high_20 (Length: 240)
Name: NF20942_high_20
Description: NF20942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20942_high_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 20 - 189
Target Start/End: Complemental strand, 4619338 - 4619169
Alignment:
| Q |
20 |
tcgagtgggagtgaaactttgagacacagcttgtaaagaatctcttcatgcattaactatatatactaatacaccccccgctcaaatttgcgagtaacgc |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4619338 |
tcgagtgggagtgaaactttgagacacagcttgtgaagaatctcttcatgcattaactatatatactaatacaccccccactcaaatttgcgagtaacgc |
4619239 |
T |
|
| Q |
120 |
ctaaggaaaattgggtgaccaaccagaaaatttccttccaattcaaatatcataatccaaactatgggat |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4619238 |
ctaaggaaaattgggtgaccaaccagaaaatttccttccaattcaaatatcataatccaaactttgggat |
4619169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 178 - 235
Target Start/End: Complemental strand, 4619138 - 4619081
Alignment:
| Q |
178 |
aaactatgggatcacgaatatttattgaatattttttggggggttgtgtctctgtgct |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4619138 |
aaactatgggatcacgaatatttattgaatattttttggggggttgtgtctctgtgct |
4619081 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University