View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20942_high_22 (Length: 238)
Name: NF20942_high_22
Description: NF20942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20942_high_22 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 11 - 221
Target Start/End: Original strand, 51705738 - 51705948
Alignment:
| Q |
11 |
atcaaatgtctggaccataccaacttatccactatgtacttttttacccttttgtatttgaatcttttaagaaggaaagaggtaaaatttgaaattgaaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51705738 |
atcaaatgtctggaccataccaacttattcactatgttcttttttacccttttgtatttgaatcttttaagaaggaaagaggtaaaatttgaaattgaaa |
51705837 |
T |
 |
| Q |
111 |
aagaaaagcaaaatcttgaattgcatctgcttcaattcaaaccatacaagaagacttctccgtggctcaggctgttccgcaaacacatttaagatatcta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51705838 |
aagaaaagcaaaatcttgaattgcatctgcttcaattcaaaccatacaagaagacttctccgtggctcaggctgttccgcaaacacatttaagatatcta |
51705937 |
T |
 |
| Q |
211 |
tctatcacatc |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
51705938 |
tctatcacatc |
51705948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University