View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20942_low_13 (Length: 278)
Name: NF20942_low_13
Description: NF20942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20942_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 20 - 271
Target Start/End: Original strand, 2821294 - 2821545
Alignment:
| Q |
20 |
gcacagtaaccaaaaacaggtggtgggtccaagccaatgggcacaacaggcttatcattgcaatcaaacatgagttccaagtctggaattttaccagggt |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2821294 |
gcacagtaaccaaaaacaggtggtgggtccaagccaatgggcacaacaggcttatcattgcaatcaaacatgagttccaagtctggaattttaccagggt |
2821393 |
T |
 |
| Q |
120 |
actttctcagtaattgcagaataccccaaacggtgaaaacatcacgtgtttgtatagcttctttgttcttgtatttctctaaatacccttttccattttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2821394 |
actttctcagtaattgcagaataccccaaacggtgaaaacatcacgtgtttgtatagcttctttgttcttgtatttctctaaatacccttttccattttt |
2821493 |
T |
 |
| Q |
220 |
taccaccaacctaaaatgcgccgttttctttgccttttccaccatttctctg |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2821494 |
taccaccaacctaaaatgcgccgttttctttgccttttccaccatttctctg |
2821545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 62 - 147
Target Start/End: Complemental strand, 11808895 - 11808810
Alignment:
| Q |
62 |
acaacaggcttatcattgcaatcaaacatgagttccaagtctggaattttaccagggtactttctcagtaattgcagaatacccca |
147 |
Q |
| |
|
|||||||||||||| | ||||||||||| |||||||| || || | || ||||||||| ||||| |||||||| ||||||||| |
|
|
| T |
11808895 |
acaacaggcttatcttcacaatcaaacataagttccaaatcaggcaacttgccagggtacaatctcaataattgcaaaatacccca |
11808810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University