View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20942_low_17 (Length: 266)
Name: NF20942_low_17
Description: NF20942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20942_low_17 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 15 - 266
Target Start/End: Original strand, 27776360 - 27776614
Alignment:
| Q |
15 |
tacttctgtgttgtgcgcctctttaaacccattcccataaaccttcccaatggccaacaagacataactagtatttggggcaccatgcacctcacaaaga |
114 |
Q |
| |
|
||||| |||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27776360 |
tacttgtgtgttatgtgcctctttaaacccattcccataaaccttcccaatggccaacaagacataactagtatttggggcaccatgcacctcacaaaga |
27776459 |
T |
|
| Q |
115 |
ctattactttatttgatgttatatatgttcctcatttttctttcaaccttatttcagttattaagcttactaatcagtcaccatgttttgtttcctttta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27776460 |
ctattactttatttgatgttatatatgttcctcatttttctttcaaccttatttcagttattaagcttactaatcagtcaccatgttttgtttcctttta |
27776559 |
T |
|
| Q |
215 |
tgatgatcattgtcttgtaaaggaaatgtatac---gaagatgattggcaaagct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
27776560 |
tgatgatcattgtcttgtaaaggaaatgaataccttgaagatgattggcaaagct |
27776614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University