View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20942_low_19 (Length: 250)
Name: NF20942_low_19
Description: NF20942
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20942_low_19 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 44 - 242
Target Start/End: Complemental strand, 51705675 - 51705473
Alignment:
| Q |
44 |
ttaaatataatcagaccatatataaat--gtaaattgctgaggttggcatgaccatttcaatttttt--gtccaattttcaaacagataatcttaaattt |
139 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
51705675 |
ttaaatataatcagaccatatataaatatgtaaattgctgaggttggcatgaccatttcaattttttttgtccagttttcaaacagataatcttaaattt |
51705576 |
T |
|
| Q |
140 |
aaatataaaagtgcgcgtttttctttgccaaccgattttgaagagaaaattcagccacaacaataaatttcgtactcttcatttaccaaactaccccttt |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
51705575 |
aaatataaaagtgcgcgtttttctttgccaaccgattttgaagagaaaattcagccacaacaataaatttcgtactgttcatttaccaaactaccccttt |
51705476 |
T |
|
| Q |
240 |
gct |
242 |
Q |
| |
|
||| |
|
|
| T |
51705475 |
gct |
51705473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University