View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20943_high_21 (Length: 346)
Name: NF20943_high_21
Description: NF20943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20943_high_21 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 4 - 245
Target Start/End: Complemental strand, 2134765 - 2134524
Alignment:
| Q |
4 |
aaggaatttgatataataatattagcaacagggtacaagagcaatgagcctagatggcttaaggttaaaaattgctctgtgatgtgacgttcttagcttt |
103 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||||| ||||| |||||||||||||| ||||| |||| ||||| |||||||| |
|
|
| T |
2134765 |
aaggaatttgatgcaataatattagcaacagggtacaagagcaatgtgcctagttggctcaaggttaaaaattgatctgttatgttacgtttttagcttt |
2134666 |
T |
|
| Q |
104 |
atcttattattgaaggacttatgaccaatcactatctaggcttgggacacatgcagagagcagaaacatacaaatgtcttcttttcttcatgcaaaacga |
203 |
Q |
| |
|
||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2134665 |
atcttattattgaagcacttatgacctatcactatctaggcttgggacacatgcagagagcagaaacatacaaatgtcttcttttcttcatgcaaaacga |
2134566 |
T |
|
| Q |
204 |
tcaaagaataaaatcagtttctttgggttctgtgcttgcttg |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2134565 |
tcaaagaataaaatcagtttctttgggttctgtgcttgcttg |
2134524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University