View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20943_high_33 (Length: 247)

Name: NF20943_high_33
Description: NF20943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20943_high_33
NF20943_high_33
[»] chr3 (1 HSPs)
chr3 (1-239)||(50235423-50235661)


Alignment Details
Target: chr3 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 50235423 - 50235661
Alignment:
1 tctagagagaaaatgaaacaatattgattggaagggataaattaattaatttgttacaatatataatgtaacaccttgatttgtgcttatgggattcgtt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50235423 tctagagagaaaatgaaacaatattgattggaagggataaattaattaatttgttacaatatataatgtaacaccttgatttgtgcttatgggattcgtt 50235522  T
101 tgttcagattgaatatatctctcacnnnnnnnnaatgattgatgtggattctttacatacgttttatggtgcataactttatgtgttttgagtaaagaat 200  Q
    |||||||||||||||||||||||||        |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
50235523 tgttcagattgaatatatctctcacttttttttaatgattgatgtggattctttacatacgttttatggtgcataactttatgtgttttgagtaaagaat 50235622  T
201 tcactattcaaaacggtgctagcctgcaatgtaggttct 239  Q
    |||||||||||||||||||||||||||||||||||||||    
50235623 tcactattcaaaacggtgctagcctgcaatgtaggttct 50235661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University