View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20943_high_39 (Length: 220)
Name: NF20943_high_39
Description: NF20943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20943_high_39 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 23 - 209
Target Start/End: Original strand, 50235200 - 50235386
Alignment:
| Q |
23 |
ccggtgaggttgcaacaccagcagctgtgccaacatccggtgccggtcaggttacaacaccagcagcatcaccttctgtggtgattgctgagtcacctga |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235200 |
ccggtgaggttgcaacaccagcagctgtgccagcatccggtgccggtcaggttacaacaccagcagcatcaccttctgtggtgattgctgagtcacctga |
50235299 |
T |
|
| Q |
123 |
gagttttggtgatgcacctgctcctgctcctagtgcctcttctcgtgccacattcagattcattggtgctgttattgcctttgcttc |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50235300 |
gagttttggtgatgcacctgctcctgctcctagtgcctcttctcgtgccacattcagattcattggtgctgttattgcctttgcttc |
50235386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 34 - 89
Target Start/End: Original strand, 50235169 - 50235224
Alignment:
| Q |
34 |
gcaacaccagcagctgtgccaacatccggtgccggtcaggttacaacaccagcagc |
89 |
Q |
| |
|
|||||||| ||||||||| |||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
50235169 |
gcaacacctgcagctgtgtcaacatccagtgccggtgaggttgcaacaccagcagc |
50235224 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University