View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20943_high_44 (Length: 212)
Name: NF20943_high_44
Description: NF20943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20943_high_44 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 192
Target Start/End: Original strand, 17799358 - 17799538
Alignment:
| Q |
17 |
cagagatatgtcgcatcaatgttttcagaatgaatatgaggaatagttgaaggaaatccgagttcatgtagaagttgttgaagccacaacaattcagctg |
116 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17799358 |
cagagatatgtcgtgtcaatgttttcagaatgaatatgaggaatggttgaaggaaatccgagttcatgtagaagttgttgaagccacaacaattcagctg |
17799457 |
T |
|
| Q |
117 |
ttgtaaatgc-----aatagttatgtaatctgcttcagttgatgatcgtgcaacagtggattgctttttgcatgacaatga |
192 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17799458 |
ttgtaaatgcaatataatagttatgtactctgcttcagttgatgatcgtgcaacagtggattgctttttgcatgacaatga |
17799538 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University