View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20943_low_22 (Length: 323)
Name: NF20943_low_22
Description: NF20943
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20943_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 17 - 102
Target Start/End: Original strand, 32702173 - 32702258
Alignment:
| Q |
17 |
aacaatcttgtctgcccagtatctttcaatattttgcaatggcatgagtacccccttatatactcacattccatttttataattag |
102 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702173 |
aacaatcttgtctgcccagtatctttcaatattttgcaaaggcatgagtacccccttatatactcacattccatttttataattag |
32702258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 67; E-Value: 9e-30
Query Start/End: Original strand, 161 - 227
Target Start/End: Original strand, 32702306 - 32702372
Alignment:
| Q |
161 |
ttgatttaaaatatctcgcaaattagctagttgtttgttgtgctcaacaatttgcaaggtgaacaca |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32702306 |
ttgatttaaaatatctcgcaaattagctagttgtttgttgtgctcaacaatttgcaaggtgaacaca |
32702372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University